noti (New England Biolabs)
New England Biolabs is a verified supplier 
New England Biolabs manufactures this product 
99
Structured Review
New England Biolabs
noti
Noti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/noti+hf/NotI-HF/pm41876484-461-36-53
Average 99 stars, based on 1175 article reviews
Noti, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1175 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/noti+hf/NotI-HF/pm41876484-461-36-53
Average 99 stars, based on 1175 article reviews
noti - by Bioz Stars,
2026-09
99/100 stars
Images
Related Articles
Digital PCR:Article Title: Combinatorial base editing couples disease correction with lineage amplification in hematopoietic stem and progenitor cells Article Snippet: .. DNA samples were digested with Polymerase Chain Reaction:Article Title: Combinatorial base editing couples disease correction with lineage amplification in hematopoietic stem and progenitor cells Article Snippet: .. DNA samples were digested with Article Title: Intrinsic disorder in elicitin-like effectors: Molecular shields in the arms race of biotrophic pathogens Article Snippet: .. In short, we digested the plasmid and the amplified inserts with Article Title: Loss of Cathepsin Z enhances pro-inflammatory macrophage responses and promotes tissue regeneration. Article Snippet: .. The PCR product was purified and digested using other:Article Title: ⍺TAT1-dependent microtubule acetylation is required for touch sensation in zebrafish but not for cilia-driven morphogenesis. Article Snippet: Acetylation of ⍺-tubulin at lysine 40 (⍺-tubK40Ac) is a conserved post-translational modification enriched on long-lived microtubules, yet its roles in vertebrate development remain incompletely defined.. In zebrafish, morpholino-based knockdown of the ⍺-tubulin acetyltransferase ⍺TAT1 has been reported to cause severe developmental defects, in contrast to genetic studies in mammals.. Here, we generated loss-of-function alleles of ⍺TAT1 in zebrafish and found that mutants, including maternal-zygotic mutants, are viable, fertile, and develop normally. Article Title: mTORC1 activity suppresses ferroptosis through a SCARB1-dependent HDL-tocopherol uptake pathway. Article Snippet: For the PCR approach, oligonucleotides comprising a 20 nucleotide Gibson overhang, the desired protospacer sequence, and a region complementary to the dual-guide library backbone were used to generate amplicons comprising sgRNA1-constant region-U6 promotersgRNA2 plus 20 nucleotide overhangs on the 5’ and 3’ end for insertion into sgRNA plasmid, double digested with BstXI (ThermoScientific # FD1024) and BlpI (ThermoScientific # FD0094), using Gibson assembly with Article Title: mTORC1 activity suppresses ferroptosis through a SCARB1-dependent HDL-tocopherol uptake pathway. Article Snippet: Dual CRISPRi/a sgRNA protospacer sequences used in this study are (i/a suffixes denote CRISPRi and CRISPRa sgRNA respectively): sgNT 1-GACGACTAGTTAGGCGTGTA 2-GCGATGGGGGGGTGGGTAGC sgGPX4i 1-GAGGCGGCCGAGGCTCATCG 2-GGAGCAGCGCCGGCTTCAGT sgGPX4a 1-GGGGAGGCAGCGCAGTTATC 2-GGCCCCGCCGTGGCCCTCAA sgSCARB1a 1-GGGGCGGGGCGCTGATCGGA 2-GGGGCAGCGGCAGCATGGCG sgFSP1a 1-GAAACGGTCCTGGCACGCTG 2-GCAGGCCCCGGAAACGGTCC sgNQO1a 1-GGGACCCAACGCCTGAATCC 2-GCACCCGCCGGAGCAACTGG sgSCDa 1-GTGCGCCGAGCCAATGGCAA 2-GGTAAACTCCGGCTCGTCAT sgLPCAT3a 1-GGGGCCTAGCGCGGCAAGGT 2-GGCGCGGCAAGGTAGGAAGA sgLDLRa 1-GCAAGAGGAGGAGTTTCGAA 2-GGCCCTGGCGACACTTTCGA sgMBTPS2i 1-GGGCGCGCGCGGTCAGCTGT 2-GGGTTCCTGAGCGGATGCTG sgNT GAACGACTAGTTAGGCGTGTA sgMTOR-1i GGGGCCTGAAGCGGCGGTAC sgMTOR-2i GGGACAGCGGGGAAGGCGGG Molecular Cell 86, 1546–1559.e1–e8, April 16, 2026 e4 CRISPR nuclease constructs were cloned by inserting protospacers into pSpCas9(BB)-2A-Puro (pX459) V2.0 (a gift from Feng Zhang; Addgene plasmid # 62988 66 ). Plasmid Preparation:Article Title: Self-organized hemanoids derived from human iPSCs create a niche that produces definitive extraembryonic hematopoiesis Article Snippet: The AAV vector plasmid was cloned into the pAAV-MCS plasmid (#240071, Agilent Technologies) containing inverted terminal repeats from AAV serotype 2 (AAV2), with a maximal packing capacity of 4,7 kb. .. The donor plasmid was assembled by standard Gibson assembly ( Table S1) of the Article Title: Intrinsic disorder in elicitin-like effectors: Molecular shields in the arms race of biotrophic pathogens Article Snippet: .. In short, we digested the plasmid and the amplified inserts with Article Title: Loss of Cathepsin Z enhances pro-inflammatory macrophage responses and promotes tissue regeneration. Article Snippet: .. The PCR product was purified and digested using Article Title: Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translation Article Snippet: For motif randomization experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT) with common RT-PCR handle sequences and bases either 3 nucleotides upstream or downstream of the modification site were randomized to 25% A/C/G/T ( ). .. For in vitro luciferase translation experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT; ) and inserted downstream of a T7 promoter and upstream of a NanoLuc sequence cloned into a pT7CFE1-His plasmid (Invitrogen, 88860) with the native T7 promoter mutated to be nonfunctional (TAATACGAgagACTATA) and cut with Amplification:Article Title: Intrinsic disorder in elicitin-like effectors: Molecular shields in the arms race of biotrophic pathogens Article Snippet: .. In short, we digested the plasmid and the amplified inserts with Purification:Article Title: Intrinsic disorder in elicitin-like effectors: Molecular shields in the arms race of biotrophic pathogens Article Snippet: .. In short, we digested the plasmid and the amplified inserts with Article Title: Loss of Cathepsin Z enhances pro-inflammatory macrophage responses and promotes tissue regeneration. Article Snippet: .. The PCR product was purified and digested using Agarose Gel Electrophoresis:Article Title: Intrinsic disorder in elicitin-like effectors: Molecular shields in the arms race of biotrophic pathogens Article Snippet: .. In short, we digested the plasmid and the amplified inserts with Transformation Assay:Article Title: Loss of Cathepsin Z enhances pro-inflammatory macrophage responses and promotes tissue regeneration. Article Snippet: .. The PCR product was purified and digested using In Vitro:Article Title: Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translation Article Snippet: For motif randomization experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT) with common RT-PCR handle sequences and bases either 3 nucleotides upstream or downstream of the modification site were randomized to 25% A/C/G/T ( ). .. For in vitro luciferase translation experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT; ) and inserted downstream of a T7 promoter and upstream of a NanoLuc sequence cloned into a pT7CFE1-His plasmid (Invitrogen, 88860) with the native T7 promoter mutated to be nonfunctional (TAATACGAgagACTATA) and cut with Luciferase:Article Title: Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translation Article Snippet: For motif randomization experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT) with common RT-PCR handle sequences and bases either 3 nucleotides upstream or downstream of the modification site were randomized to 25% A/C/G/T ( ). .. For in vitro luciferase translation experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT; ) and inserted downstream of a T7 promoter and upstream of a NanoLuc sequence cloned into a pT7CFE1-His plasmid (Invitrogen, 88860) with the native T7 promoter mutated to be nonfunctional (TAATACGAgagACTATA) and cut with Sequencing:Article Title: Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translation Article Snippet: For motif randomization experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT) with common RT-PCR handle sequences and bases either 3 nucleotides upstream or downstream of the modification site were randomized to 25% A/C/G/T ( ). .. For in vitro luciferase translation experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT; ) and inserted downstream of a T7 promoter and upstream of a NanoLuc sequence cloned into a pT7CFE1-His plasmid (Invitrogen, 88860) with the native T7 promoter mutated to be nonfunctional (TAATACGAgagACTATA) and cut with Clone Assay:Article Title: Investigation of TRMT61B methyltransferase activity on mRNA and its effects on translation Article Snippet: For motif randomization experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT) with common RT-PCR handle sequences and bases either 3 nucleotides upstream or downstream of the modification site were randomized to 25% A/C/G/T ( ). .. For in vitro luciferase translation experiments, 150–250 nucleotide sequences surrounding the m 1 A sites were commercially purchased (IDT; ) and inserted downstream of a T7 promoter and upstream of a NanoLuc sequence cloned into a pT7CFE1-His plasmid (Invitrogen, 88860) with the native T7 promoter mutated to be nonfunctional (TAATACGAgagACTATA) and cut with |